Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia Telangiectasia Patients: Introducing Two Novel Mutations
DOI:
https://doi.org/10.18502/ijaai.v24i2.18147Keywords:
Ataxia-telangiectasia; Ataxia telangiectasia mutated proteins; Cerebellar ataxia; Iran; Mutation; Primary immunodeficiency diseases; Whole exome sequencingAbstract
Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused
by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. In this study, we review the clinical characteristics of 13 A-T patients, 2 of whom displayed novel mutations.
Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing.
We identified 11 different mutations in the ATM gene. Two patients had mutations as
compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 2 likely pathogenic mutations (ie, c.2639-1G>A and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported.
Our study highlights the significance of next-generation sequencing techniques in identifying novel ATM mutations in A-T patients. Although all reported A-T mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of A-T and underscores the potential clinical implications of identifying novel mutations.