Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia Telangiectasia Patients: Introducing Two Novel Mutations

Mohsen  Badalzadeh; Maryam  Soleimani BavanI; Zahra  Alizadeh; Milad  Mirmoghtadaei; Leila  Shakerian; Seiamak  Bahram; Anne  Molitor; Raphael  Carapito; Leila  Moradi; Anahita  Razaghian; Raheleh  Assari; Masoud  Movahedi; Mansoureh  Shariat; Massoud  Houshmand; Laleh  Habibi; Amir Ali  Hamidieh; Mahmoud Reza  Ashrafi; Mohammad Reza  Fazlollahi; Zahra  Pourpak

doi:10.18502/ijaai.v24i2.18147

Mohsen Badalzadeh Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Maryam Soleimani BavanI Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Zahra Alizadeh Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Milad Mirmoghtadaei Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Leila Shakerian Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Seiamak Bahram Laboratoire d’ImmunoRhumatologie Moléculaire, plateforme GENOMAX, INSERM UMR_S 1109, Faculté de Médecine, Fédération Hospitalo-Universitaire OMICARE, Fédération de Médecine Translationnelle de Strasbourg (FMTS), LabEx TRANSPLANTEX, Université de Strasbourg, Strasbourg, France
Anne Molitor Laboratoire d’ImmunoRhumatologie Moléculaire, plateforme GENOMAX, INSERM UMR_S 1109, Faculté de Médecine, Fédération Hospitalo-Universitaire OMICARE, Fédération de Médecine Translationnelle de Strasbourg (FMTS), LabEx TRANSPLANTEX, Université de Strasbourg, Strasbourg, France
Raphael Carapito Laboratoire d’ImmunoRhumatologie Moléculaire, plateforme GENOMAX, INSERM UMR_S 1109, Faculté de Médecine, Fédération Hospitalo-Universitaire OMICARE, Fédération de Médecine Translationnelle de Strasbourg (FMTS), LabEx TRANSPLANTEX, Université de Strasbourg, Strasbourg, France
Leila Moradi Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Anahita Razaghian Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Raheleh Assari Children's Medical Center, Pediatrics Center of Excellence, Tehran University of Medical Sciences, Tehran, Iran
Masoud Movahedi Children's Medical Center, Pediatrics Center of Excellence, Tehran University of Medical Sciences, Tehran, Iran
Mansoureh Shariat Department of Immunology and Allergy, Children's Medical Center Hospital, Tehran University of Medical Sciences, Tehran, Iran
Massoud Houshmand Department of Medical Genetics, National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
Laleh Habibi Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Amir Ali Hamidieh Pediatric Cell and Gene Therapy Research Center, Gene, Cell & Tissue Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Mahmoud Reza Ashrafi Children's Medical Center, Pediatrics Center of Excellence, Tehran University of Medical Sciences, Tehran, Iran
Mohammad Reza Fazlollahi Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran
Zahra Pourpak Immunology, Asthma and Allergy Research Institute, Tehran University of Medical Sciences, Tehran, Iran

DOI: https://doi.org/10.18502/ijaai.v24i2.18147

Keywords: Ataxia-telangiectasia; Ataxia telangiectasia mutated proteins; Cerebellar ataxia; Iran; Mutation; Primary immunodeficiency diseases; Whole exome sequencing

Abstract

Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused
by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. In this study, we review the clinical characteristics of 13 A-T patients, 2 of whom displayed novel mutations.

Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing.

We identified 11 different mutations in the ATM gene. Two patients had mutations as

compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 2 likely pathogenic mutations (ie, c.2639-1G>A and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported.

Our study highlights the significance of next-generation sequencing techniques in identifying novel ATM mutations in A-T patients. Although all reported A-T mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of A-T and underscores the potential clinical implications of identifying novel mutations.